Identification of Frataxin as a regulator of ferroptosis

2.1. Antibodies and reagents

The antibody to Frataxin (ab219414), to Aconitase 2 (ab129069), to Aconitase 1 (ab126595), to IREB2 (ab181153), to NDUFV2 (ab183717), to FECH (ab137042), to Transferrin Receptor (ab80194), SDHB (ab14714), to Ferritin Heavy Chain (ab65080), to beta Actin (ab8226) and N-acetylcysteine (NAC), glutathione (GSH) and DCFH-DA were obtained from Abcam (Cambridge, MA). CCK-8 Assay Kit was obtained from Meilunbio (Dalian, China). CFDA-SE, GSH Assay Kit was purchased from Beyotime (Shanghai, China). Erastin, Sorafenib, Ferrostatin-1, Z-VAD-FMK, Necrosuifonamide were obtained from Selleck Chemicals (Houston, TX). C11-BODIPY (581/591), TMRE, MitoTracker were obtained from Thermo Fisher Scientific (Waltham, MA). The Cell Cycle Staining Kit was purchased from MultiSciences (Hangzhou, China).

V体育官网 - 2.2. Cell culture

Human fibrosarcoma HT-1080 cells were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM medium (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA), supplementary with 100 U/mL penicillin and 100 μg/ML streptomycin. Cells were maintained in an incubator with a humidified atmosphere of 5% CO₂ at 37 °C.

2.3. Cell viability assay

Cell viability assay was evaluated using the CCK8 Assay Kit. HT-1080 cells were seeded at a density of 4 × 10⁴ cells/well in 100 μl DMEM medium in the 96-well plate for overnight, followed by treatment with different doses of erastin for 12 h. 10 μl CCK-8 was added to each well and the cells were subsequently incubated at 37 °C for 2 h. Absorbance was measured at 450 nm using the microplate reader.

2.4. PI staining

Cells were plated in 96-well plates at a density of 4 × 10⁴ cells/well and treated with the indicated concentration of erastin. Propidium iodide (PI) was then added to each well at a final concentration of 10 μg/mL for 10 min in the dark, and cells were subjected to fluorescence microscopy.

2.5. Transwell assay (V体育官网)

HT-1080 cells (4 × 10⁴) in 200 μl serum-free DMEM medium were seeded onto the upper transwell chambers, while 500 μl medium containing 5% FBS was added to the lower chambers. The cells were cultured at 37 °C in an incubator for 24 h. The transwell chambers were then removed, washed with PBS twice, fixed in 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 20 min at room temperature. Next, PBS was used to wash chambers, and the un-migrated cells in the upper transwell membrane were gently wiped off using a cotton swab. Images were observed and photographed using an inverted light microscope.

"V体育官网" 2.6. Cell growth assay

HT-1080 cells were seeded in a 96-well plate at a density of 3 × 10³ cells/well in 100 μl DMEM medium containing 10% FBS. The cells were incubated overnight at 37 °C in an incubator. From the second day after plating, the numbers of cells were measured at the specified time using the CCK8 Assay Kit. Next, a microplate reader was used to measure the absorbance at 450 nm.

2.7. Cell proliferation assay

Cell proliferation was detected using a CFDA-SE probe. Briefly, HT-1080 cells stained with CFDA-SE according to the manufacturer's protocol and seeded in 6-well plates. Then, cells were exposed to the same concentration of erastin. CFDA-SE fluorescence was detected by the flow cytometry.

2.8. Cell cycle analysis

Cell cycle profiles were examined by the Cell cycle staining Kit (MultiSciences, Hangzhou, China) according to the manufacturer's instructions. Briefly, cells were harvested, washed and fixed in ice-cold 70% ethanol at 4 °C overnight. Then they were washed, treated with 100 μl RNase A at 37 °C for 30 min and stained with 400 μl PI at 4 °C in the dark for 30 min. Finally, the cells were washed and analyzed by flow cytometry.

V体育ios版 - 2.9. Colony formation assay

3 × 10³ cells were seeded in a 6-well plate. After incubation for 2 weeks, the colonies were washed with PBS, fixed with 4% paraformaldehyde, and then stained with crystal violet. The colonies were photographed by the inverted microscope.

2.10. Soft agar colony formation assay (V体育官网)

6-well plates were covered with a bottom layer of 2 ml 0.8% agar in 10% FBS-DMEM. Then 3 × 10³ cells were suspended in 2 ml of 10% FBS-DMEM containing 0.4% agarose and seeded to the top of a 0.8% agarose. After two weeks, colonies were fixed with 4% paraformaldehyde for 30 min, stained with dilute crystal violet for 20 min. The colonies were photographed by the inverted microscope.

"VSports app下载" 2.11. Determination of ROS production

ROS levels in cells were measured by using 2ʹ,7ʹ-dichlorofluore scin diacetate (DCFH-DA). After treatment with erastin(5 μM), cells were washed with serum-free culture medium and incubated with 4 μM DCFH-DA in the dark at 37 °C for 30 min. Cells were then washed and harvested, suspended in serum-free culture and fluorescence intensity was measured by flow cytometry.

2.12. Lipid peroxidation

Lipid peroxidation was measured with C11-BODIPY (581/591). When lipid peroxidation increased, the fluorescence is undergoing a shift from red to green fluorescence emission. HT-1080 cells in 6 well plates were incubated with the indicated concentrations of erastin. 2.5 μM C11-BODIPY(581/591) was added and incubated at 37 °C for 30 min. Excess C11-BODIPY was removed by washing the cells twice with Hanks buffer. Cells were harvested and resuspended for flow cytometry analysis.

"VSports app下载" 2.13. Confocal microscopy assay

The cells were seeded in a chamber confocal dish and treated with the indicated concentration of erastin. Then 581/591 C11- BODIPY (5 μM) or MitoTracker(100 nM) or RPA(4 μM) were co-staining with DAPI(10 mg/ml) in the dark for a 30 min incubation. Representative images were viewed under a confocal microscope.

2.14. Measurement of mitochondrial membrane potential (MMP)

The changes of mitochondrial membrane potential (MMP) were observed by tetramethylrhodamine methyl ester (TMRE) probe. HT-1080 cells were treated with 5 μM erastin for 12 h and then stained with TMRE (100 nM) for 30 min. The stained cells were washed with PBS twice, and analyzed using the flow cytometry.

"V体育安卓版" 2.15. Iron assay

The mitochondrial chelatable iron pool was assessed using Rhodamine B-[(1, 10-phenanthroline-5-yl)-aminocarbonyl]benzyl ester (RPA), a Fe²⁺ specific fluorescent sensor. After treatment, cells were harvested and incubated with 2 μM RPA for 15 min at 37 °C in Hanks balanced salt solution(HBSS), then washed subsequently three times with HBSS. The samples were incubated with dye-free HBSS for another 15 min following washing once with HBSS. Mitochondrial iron was measured using flow cytometry.

2.16. Determination of iron concentrations in isolated mitochondria and cytoplasm by ICP-MS (V体育官网入口)

Total iron concentration was measured using inductively coupled plasma mass spectrometry (ICP-MS, Agilent, Varian) as previously described [20]. In brief, indicated cells were washed, trypsinized and subjected to the subcellular fractions isolation kit (Beyotime, Shanghai, China). Fractions were lysed and quantified by BCA Protein Assay Kit. Each aliquot of the lysed sample was prepared for ICP-MS analyses. Quadruplicate determinations of iron concentration were performed for each sample. The results were conversions from raw ppb values and expressed as pmol/100 mg protein.

2.17. GSH detection

Intracellular GSH levels were examined by using a GSH Assay Kit (Beyotime, Shanghai, China). HT-1080 cells were treated with erastin for 24 h. Then, the subsequent procedures were performed according to the manufacturer's instructions. The experimental data were obtained by a microplate reader.

2.18. Transmission electron microscope (TEM)

After indicated treatment, The cells were fixed by the 2.5% glutaraldehyde solution at 4 °C overnight. After fixation, the samples were dehydrated by a graded series of ethanol, then dehydrated by alcohol and eventually transferred to absolute acetone. Following Infiltration with absolute acetone and the final Spurr resin mixture, the samples were embedded, ultrathin sectioned and stained. Finally, the samples were observed in the Hitachi Model H-7650 transmission electron microscope.

2.19. Plasmids

For knockdown of FXN, target shRNA sequences were subcloned into pLVX-shRNA Lentivector (Takara). The two shRNA knockdown sequences for FXN were forward: 5′- GATCCGCTGGACTCTTTAGCAGAGTTTTCAAGAGAAACTCTGCTAAAGAGTCCAGCTTTTTTG-3′, and 5′- GATCCGCAGACGCCAAACAAGCAAATTTCAAGAGAATTTGCTTGTTTGGCGTCTGCTTTTTTG-3’. Human full-length FXN or FTH cDNA was amplified by RT–PCR using HEK-293 mRNA and verified by sequencing. Then the cDNA was subcloned into pLVX -Neo lentivirus vector (Takara, Dalian, China) by ClonFast Seamless Cloning kit (obio, Nanjing, China). The plasmid ofshRNA resistant form of FXN (Res-FXN) was generated according to the described methods by introduced silent changes in the coding region targeted by the shRNA [21].

2.20. Lentiviral transduction

The recombinant lentiviral plasmids were verified by sequencing and co-transfected with pMD2G, pSPAX2 into HEK293 cells to produce recombinant lentiviral. Lentivirus infections were carried out as described previously [12]. Briefly, the cell seeded in 24-well plates reached 70–80% confluence, the 10%-DMEM medium was removed. Cells were then transfected with the corresponding lentivirus. After two days, puromycin or G418 were added for screening . Then the stable cells were maintained in puromycin or G418. The expression efficiency was evaluated by RT-PCR and western blot analysis.

2.21. Western blotting

Following treatment, the cells were lysed in RIPA buffer after washing with PBS and incubated on ice for 30 min. Then cellular debris was removed by centrifugation and the protein concentration was quantified with BCA Protein Assay Kit. Subsequently, equal amounts of protein were separated by SDS–PAGE and transferred to PVDF membranes. The membranes were blocked with 5% skim milk for 1 h and incubated with the primary antibodies at 4 °C overnight. After washing three times with TBST, the membranes were incubated with the secondary antibodies at room temperature for 1 h and washed again. The blots were visualized using a chemiluminescence detection kit ECL-PLUS.

2.22. RNA isolation and quantitative real-time PCR (RT-PCR)

Cells were lysed using Trizol reagent (Invitrogen, USA) and total RNA was extracted with chloroform and isopropyl alcohol. cDNA was then synthesized using a reverse transcription reagent kit (TaKaRa, Dalian, China) according to the manufacturer's protocols. The SYBR Green Master Mix Kit was used for relative quantification of RNA levels according to the manufacturer's instructions. GAPDH was chosen as an internal control. The sequences of the primers were as follows: GAPDH, forward, 5′-GCACCGTCAAGGCTGAGAAC, reverse, 5′-ATGGTGGTGAAGACGCCAGT; FXN, forward, 5′-TAGCAGAGGAAACGCTGGAC, reverse, 5′-ACGCTTAGGTCCACTGGATG. The expression level was normalized to the internal control and determined by a 2^-ΔΔCT method.

V体育ios版 - 2.23. Determining mitochondrial DNA (mtDNA) copy number

Quantitation of the mitochondrial DNA copy number relative to the nuclear DNA was carried out by using real-time PCR. Primer specific for HGB1 genes were used for the determination of nuclear DNA (nDNA). This primer sequences were used as follows: forward primer, 5′-GTGCACCTGACTCCTGAGGAGA-3′; reverse primer, 5′-CCTTGATACCAACCTGCCCAG-3′. And another primer (ND-1) for the detection of mtDNA. The primer sequences were as follows: forward primer, 5′-CCCTAAAACCCGCCACATCT-3′; reverse primer, 5′-GAGCGATGGTGAGAGCTAAGGT-3′. Q-PCR was performed and the mtDNA copy number was calculated. The thermal cycling conditions for the nDNA and mtDNA amplification were 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, 55 °C for 15 s, and 72 °C for 1 min.

V体育官网 - 2.24. Mouse xenograft model

4–6 weeks old male BALB/c nude mice were used to construct xenograft models. 2.5 × 10⁶ HT-1080 cells suspended in 0.1 mL PBS were injected subcutaneously into the nude mice. After 7 days, tumor growth was detectable and monitored every 2 days. Tumor volume in mm³ was determined by measuring the longest diameter (a) and shortest width (b) and calculated by using the following formula: volume (mm³) = 0.5 × a × b². On the 12th day, mice were euthanized and tumors were isolated.

2.25. H&E analysis (V体育官网)

Tumors collected from mice were fixed in 4% paraformaldehyde. The paraffin-embedded samples were cut to 4 μm thickness and stained with H&E (Sigma). Stained sections were viewed and photographed under a microscope.

2.26. Immunohistochemistry (IHC)

Tissues were fixed with 4% paraformaldehyde and embedded in paraffin. The paraffin-embedded block tissues were cut into 4 μm sections and followed dewaxed, hydrated and antigen retrieval. After washing with PBS three times, the slides were treated with 3% hydrogen peroxide for 15 min, washed with PBS, blocked with BSA for 15 min at room temperature. Subsequently, anti-FXN antibody (1:200), anti-FTH antibody (1:100) were added to the sections at 4 °C for overnight. The streptavidin peroxidase method was used for signal detection and then stained by diaminobenzidine (DAB) and counterstained with hematoxylin. The sections were observed and photographed under the light microscope. All slides were scored by two independent observers in a blinded fashion.

2.27. Statistical analysis

All statistical calculations were performed using GraphPad Prism (version 7.0). All results were presented as the mean ± standard deviation (SD). The differences between the two groups were performed by the Student's t-test. Comparisons among multiple groups were analyzed by the one-way ANOVA. P < 0.05 was considered to be significant.

3.1. FXN knockdown repressed the proliferation of HT-1080 cells

FXN stable knockdown cells were generated through lentivirus transduction by two separate short hairpin RNA sequences. Western blot and real-time PCR were used to detect FXN expression. As expected, the knockdown approach dramatically reduced RNA levels and protein expression of FXN in the shRNA cells (Fig. 1A, B). Using these cells, we found that FXN depletion did not lead to cell death, but instead inhibited cellular proliferation (Fig. 1C). To further determine whether the decreased cell proliferation was affected by the cell cycle distribution or not. Cell cycle distribution assay was performed followed by flow cytometry and showed cells were arrested at G0/G1 phase (Fig. 1D, E). Furthermore, the capacity of long-term cell viability between the stably FXN knockdown and control cells was detected by colony formation and soft agar assay (Fig. 1F-I). The results showed FXN suppressed significantly inhibited the capacity of colony formation. Besides, transwell assays were performed to determine the migration of HT-1080 cells and revealed that FXN knockdown dramatically inhibited the migration of HT-1080 cells (Fig. 1J, K). Notably, the high FXN expression indicated a significantly poorer overall survival rate in sarcoma, acute myeloid leukemia, bladder urothelial carcinoma, and adrenocortical carcinoma patients based on The Cancer Genome Atlas (TCGA) datasets (Fig. S1). Taken together, these results discover that FXN plays a vital role in the molecular biological characteristics of cancer and might be a potential indicator of poor prognosis.

VSports在线直播 - 3.2. FXN knockdown induced the dysfunction of mitochondria and accumulation of free iron

As FXN is a conserved mitochondrial protein, we next examined the mitochondrial function in the FXN suppressed HT-1080 cells. Firstly, mitochondria were labeled with the mitotracker probe and observed by a confocal laser scanning microscope. The control cells showed a network of elongated mitochondria, in contrast, the FXN knockdown cells appeared fragmentation and accumulation around the nucleus, indicating that FXN depletion resulted in the dysfunction of mitochondrial homeostasis (Fig. 2A). For the close association of mitochondrial morphology with functionality, we next monitored the changes of mitochondrial membrane potential (MMP) through TMRE staining followed by flow cytometry. The results confirmed that the MMP of HT-1080 cells with two different FXN knockdown sequences appeared significant hyperpolarization (Fig. 2B). Earlier published paper has proved that excessive elevating of MMP does not help to accelerate ATP production, but assist the production of free radicals exponentially [22].

The above studies demonstrate that FXN plays a role in maintaining mitochondrial function; it is unclear the regulation loop between FXN and the activity of oxidative phosphorylation. We next tested the mitochondrial oxygen consumption rate (OCR) by extracellular flux analyzer, which reflected the main mitochondrial function of energy respiration. As showed in Fig. 2C, knockdown of FXN remarkably decreased the oxygen consumption in mitochondria. The basal respiration, maximal respiration and spare respiration, three indices that represent mitochondrial respiration flux revealed a significant decline, demonstrating that FXN knockdown disrupted the process of oxidative phosphorylation (Fig. 2D, E, F). Moreover, ATP production was also calculated and a pronounced loss of ATP exhibited in the FXN knockdown cells, which was unable to meet the cellular ATP demands for supporting cell growth (Fig. 2G). Collectively, the mitochondrial OCR tested by Seahorse XF96 Analyzer uncovered an important link between FXN and oxidative phosphorylation.

Besides energy respiration, ISC assembly is another important process that takes place in mitochondria and considered to be essential for viability. Thus, ISC turnover in iron-sulfur protein was monitored in several ways. Above all, the activity of mitochondrial and cytoplasmic aconitase, important [4Fe– 4S] proteins that catalyze the reaction from citric acid to isocitrate, were analyzed by the in-gel activity assay. And the breakdown of mitochondrial ISC assembly resulted in a more dramatic decrease of cytoplasmic aconitase activity than m-aconitase activity, without obvious changes of protein level, demonstrating FXN depletion promoted the loss of the aconitase ISCs (Figs. 2H, I, S2A). It has been reported cellular iron-responsive protein1 (IRP1) and IRP2 play a central role in the regulation of iron metabolism. Apo form of cytoplasmic aconitase transformed into IRP1, which could promote the degradation of ferritin heavy chain (FTH1) mRNA and stabilize transferrin receptor 1 (TFR1) mRNA through IRP-IRE mechanism, thus leading to the iron starvation response. Increased iron starvation response was also confirmed by the upregulated IRP2, TFR and downregulated FTH (Fig. 2J). For the importance of FXN in the de novo ISC biogenesis and impaired mitochondrial OXPHOS in FXN suppressed cells, we also measured the expression of SDHB and NDUFV2, subunits of complexes I and II whose electron transfer function rely on the intact ISC cluster. Pronounced depletion of SDHB and NDUFV2 was detected in FXN knockdown cells. In addition, the [2Fe–2S] binding FECH, a rate-limiting enzyme in heme biosynthesis, and lipoic acid harbored in PDH E2, KGDH E2 which represented the activity of [4Fe–4S] binding lipoic acid synthase were also significantly decreased (Fig. 2K). These data conclude that FXN depletion reduce steady-state levels of Fe–S cluster dependent proteins as well as reactions and subsequent activation of the iron starvation stress. Besides, in line with previous studies that NRF2, an important transcription factor in regulating cellular redox homeostasis, was downregulated in FXN suppressed cells [23,24]. The mechanism involved may be transcription-independent (protein-protein interaction), for the increased levels of cytosolic Kelch-like ECH-associated protein 1 and a similar level of NRF2 mRNA under FXN suppression (Fig. S 2B, C).

We next used the selective yield fluorescence probe RPA, whose cationic fluorophore could rapidly quench by Fe²⁺ ions, to detect the cellular labile iron. As showed in Fig. 2L, FXN knockdown induced a pronounced accumulation of free Fe²⁺ ions with the decreased fluorescence of RPA. The quantitation of the RPA fluorescence was shown in Fig. S2D. For the observed reduction of OCR, we subsequently monitored the mtDNA copy number, which encodes 13 polypeptides playing crucial roles in the OXPHOS. Consistent with this finding, the mtDNA copy number appeared a clearly decrease in the FXN knockdown cells (Fig. 2M). Collectively, these findings provide a pivotal role of FXN in maintaining the homeostasis of mitochondrial and keep the balance of iron metabolism.

3.3. Suppression of FXN enhanced erastin-induced ferroptosis

We wondered whether suppression of FXN accelerated the process of ferroptosis cell death. Erastin, system X_c^– cystine/glutamate antiporter (xCT) inhibitor, which can depress cysteine levels, was applied to induce ferroptosis in HT-1080 cells. FXN knockdown and control cells were exposed to erastin treatment for 12 h and suppression of FXN expression significantly enhanced erastininduced cell death. The concentrations of IC50 values for control were evidently higher than that of two FXN knockdown cells, which calculated results were 4.130 μM and 5.527 μM, respectively (Fig. 3A). We obtained a similar phenomenon in U266 and Kasumi-1 cells (Fig. S3 A, B), indicating that FXN sensitized cells to ferroptosis was not restricted to only a single cell lineage. Of note, IKE, another cystine/glutamate antiporter inhibitor, also cooperate with FXN suppression to induce cell death. On the contrary, suppression of FXN expression did not affect cell death induced by other ferroptosis inducers, including RSL3 (GPX4 inhibitor) and BSO (GSH synthase inhibitor) (Fig. S3 C).

Erastin-induced ferroptosis would lead to a disruption of cell membrane permeability, therefore enabled propidium iodide (PI) staining to monitor the progress. The PI staining assay manifested that suppression of FXN expression remarkably induced HT-1080 cell death following erastin treatment. Phase-contrast microscopy also showed FXN depleted cells became shrinking followed by condensation of cytoplasmic constituents, like a “ballooning” phenotype, upon erastin treatment (Fig. 3B). These findings indicated FXN knockdown significantly augmented erastininduced ferroptotic cell death. In addition, we investigated the proliferation rate of diverse cells exposed to a low concentration of erastin and carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) fluorescence intensity which exponentially decreased with cell proliferation and division was analyzed by flow cytometry. The result indicated that erastin obviously attenuated cell proliferation of HT-1080 cells, which was much more significant upon FXN depletion cells (Fig. 3C). Furthermore, Dramatic morphological changes of mitochondria were observed by transmission electron microscopy in FXN depletion cells comprising mitochondrial fragmentation, vacuolization and cristae enlargement, which was aggravated under treatment with erastin (Fig. 3D).

As the accumulation of lipid peroxidation and free iron level were two critical drivers of ferroptosis. The fluorescent staining of BODIPY C11, a sensitive fluorescent reporter for lipid peroxidation, was used to quantify the formation of lipid peroxidation in live cells by flow cytometer and confocal laser microscope. Increasing levels of lipid peroxides were monitored in indicated HT-1080 cells after erastin treated for 12 h, and FXN deletion significantly promoted lipid peroxide formation upon erastin treatment with red fluorescence of the BODIPY shifted to green fluorescence. But FXN depletion alone could not stimulate the accumulation of lipid peroxidation (Fig. 3E, H). Quantitation of the confocal fluorescence was provided in Fig. S3 D. We also discovered similar results that FXN accelerated the accumulation of lipid peroxidation and ROS under the exposure of erastin in U266 cells (Fig. S3 E, F). We next asked whether alteration of GSH level participated in the FXN dependent ferroptosis, and found FXN depletion alone was not enough to reduce GSH level. But under ferroptotic stress, such as erastin treatment, FXN depletion accelerated the decrease of GSH (Fig. S3 G). Given that iron enables to produce superoxide radicals via the Fenton reaction and result in lipid peroxidation. We next assessed the cellular labile iron pool by RPA probe and found FXN suppression robustly activated the labile iron level under the erastin exposure (Fig. S3 H). In consistent with RPA fluorescence, we also found that FXN depletion activated the iron-starvation response, which was far more robust under the treatment of erastin (Fig. S3 I).

Mitochondrial dysfunction and oxidative stress are the other two characteristics of ferroptosis. We hypothesized that FXN accelerated ferroptosis was associated with the increased of MMP and cytoplasm ROS. Indeed, the elevated levels of MMP and cytoplasm ROS induced by erastin were significantly aggravating by the suppression of FXN (Fig. 3F, G). To further validate that FXN knockdown specifically enhanced the ferroptotic process, we used different signal pathway inhibitors to observe the rescue effect. Notably, erastin-induced cell death was able to reverse by the ferroptosis inhibitor ferrostatin-1 and GSH, but not by the apoptosis inhibitor ZVAD-FMK and necroptosis inhibitor necrosulfonamide (Fig. 3I).

Several studies have revealed that autophagy-dependent degradation of ferritin, a process named ferritinophagy, takes place in ferroptosis. To distinguish whether FXN regulates ferroptosis through modulating autophagy. The conversion of LC3 was detected in FXN depletion and control cells in the absence or presence of erastin. Alterations of FXN expression did not affect the erastin-induced formation of lipidated LC3B (Fig. S3 J). A similar phenomenon was showed that pharmacological inhibition of autophagy by BafA1 could not reverse the FXN induced ferroptosis (Fig. 3I), indicating autophagy was not involved in the FXN dependent ferroptosis. Together, these studies demonstrate that FXN depletion is capable of accelerating erastin induced ferroptosis, most likely due to the breakdown of the ISC biosynthetic machinery and mitochondrial dysfunction.

V体育ios版 - 3.4. Overexpress of FXN contributed to ferroptosis resistance

To shed more light on the specific order of events in modulating mitochondrial function and ferroptosis by FXN, ectopic expression of FNX cell was generated and the proliferation rate was analyzed by the CFDA-SE probe. The results showed that FXN overexpression obviously increased cell proliferation of HT-1080 cells (Fig. 4A). In contrast with mitochondrial dysfunction in FXN suppression cells, ectopic expression of FXN markedly increased mtDNA copy number and decreased the liable iron level (Figs. 4B, D, S4A). Next, we asked whether overexpression of FXN in HT-1080 cells could diminish erastin-induced ferroptosis. As shown in Fig. 4C, cell viability assays of the indicated cells experienced that ectopic expression of FXN sensibly abolished erastin-induced growth inhibition compared to the control and FXN depletion cells. To further verify the specificity of the observed phenomenon, we generated an shRNA-resistant FXN cDNA (Res-FXN) and co-transduced with shFXN. Indeed, overexpression of an shRNA resistant form of FXN efficiently restored the growth inhibition of erastin (Figs. S4B and C). Similarly, expression of Res-FXN conferred resistance to xCT inhibitors, IKE, but not to RSL3 and BSO (Fig. S4D). In consistent with the results of RPA, mitochondrial and cytoplasmic iron measured by ICP-MS demonstrated that knockdown of FXN induced the accumulation of iron in both fractions, while ectopic expression of Res-FXN decreased the level of iron(Figs. S4E and F). Collectively, these findings indicate that expression of FXN is directly responsible for the observed phenotypes and excluding the possibility of off-target effects. More details were found with the mitochondrial morphological changes through MitoTracker fluorescence staining and transmission electron microscopy. The results showed that FXN expression could keep mitochondrial morphology integrity, without severe mitochondrial fragmentation or vacuolization changes under erastin treatment (Fig. 4E, F).

As FXN expression robustly decreased cellular free iron contents, another important question was whether FXN expression could rescue the erastininduced accumulation of lipid peroxidation. In line with previous findings, FXN expression restored the erastinchallenged lipid peroxidation (Figs. 4G, H, S4G). In addition, ferroptosis inhibitors (ferrostatin-1 and GSH) and DFO restored much less in the FXN overexpression cells than knockdown cells (Fig. 4I). Collectively, these results imply that FXN expression significantly suppresses erastin-induced ferroptosis.

3.5. Free iron depletion enhanced the resistance to ferroptosis in the FXN knockdown cells

The above results suggested that FXN suppression dramatically induced mitochondria dysfunction and activated the iron-starvation response, thus accelerating erastin-challenged ferroptosis. Since ferritin heavy chain (FTH) has ferroxidase activity and oxidizes Fe²⁺ to catalytically inactive Fe³⁺ and plays a vital role in maintaining iron homeostasis by storing iron in a soluble, non-toxic form. We, therefore, hypothesized that overexpression of FTH might restore dysregulated iron homeostasis in the FXN suppression HT-1080 cells. To test this hypothesis, we reconstituted the expression of iron storage protein FTH in FXN suppression HT-1080 cells and firstly explored the effects on the cell proliferation and mitochondrial function. As expected, the FTH overexpressed cells eliminated the proliferation arrest induced by FXN suppression and accelerated the formation of cell colony, manifesting that iron homeostasis regulation could modulate the injury derive from FXN knockdown (Fig. 5A, B). The quantification of free iron level revealed that FTH expression sensibly blocked the iron accumulation stimulated by FXN suppression (Figs. 5C, D, S5A). Similarity, mitotracker staining also showed a significantly increased network of tubule-shaped morphology, which characteristic for healthy and functional mitochondria under the recombinant expression of FTH in FXN suppression cells (Fig. 5E). Additionally, we evaluated the mitochondrial DNA copy and found that FTH recombinant expression could reverse the decrease of mitochondrial DNA copy (Fig. 5F). In summary, these data emphasize the fact that FTH expression restores mitochondrial impairment induced by FXN suppression.

Based on the observed results, we next studied whether FTH expression could rescue the ferroptosis induced by erastin in FXN suppression cells. And the results showed suppression of FXN increased erastin-induced cell death, while reconstituted expression of FTH significantly restored the ferroptosis cell death (Fig. 6A). CCK8 assay was used to evaluate the potency of FTH to restored erastin-induced cell death and results showed FTH fully restored the erastin-induced phenotypes (Fig. 6B). Cells transduced with shFXN displayed noticeable altered mitochondrial shape and size, including mitochondrial fragmentation, vacuolization and loss of cristae enlargement, whereas these phenotypes were reversed by FTH overexpression through reducing cellular iron even with the treatment with erastin (Fig. 6C).

In addition, overexpression of FTH was able to rescue the accumulation of lipid peroxidation and cytoplasm ROS in the FXN knockdown cells upon erastin exposure (Fig. 6D, E). Consistent with these results, pharmacologically chelate free iron by DFO also prevented cell death of FXN suppression cells to a similar extent as the control under the treatment of erastin (Fig. 4I). In summary, our results emphasize the decisive role of FXN in the regulation of cysteine deprivation-induced ferroptosis through modulating iron homeostasis, which alleviating by the iron depleted.

3.6. Knockdown of FXN inhibited the growth of xenograft in vivo

To evaluate the effect of FXN knockdown on proliferation in vivo, FXN suppression HT-1080 cells with or without FTH recombinant expression were subcutaneously injected into nude mice. The growth condition of xenograft tumors was traced, which manifested that FXN silencing indeed blocked the proliferation of tumor in vivo, while overexpression of FXN or FTH accelerated the tumor growth (Fig. 7A). Further, H&E and IHC staining were performed and results showed that there were large necrosis areas in FXN silenced tumor tissues, accompanied by nuclear condensation, fragmentation and a significantly decreased Ki-67 expression (Fig. 7B). Inversely FXN overexpression not only maintained the tumor morphology but also promoted the expression of Ki-67. FTH expression was also detected by IHC staining and consistent with the data in vitro that FXN knockdown robustly activated iron starving stress and decreased the FTH expression, which significantly restored by FXN overexpression. In addition, FTH expression could also reverse the phenomenons exhibited in FXN knockdown xenograft, including inhibited tumors growth and decreased Ki-67 expression. These observations lead to the hypothesis that FXN or the downstream iron homeostasis associated protein can be developed as a therapeutic target, leaving cancer cells at increased risk of ferroptotic cell death.